Cyp2b10 gene card
WebNov 23, 2024 · CYP2B10 is responsible for metabolism and detoxification of many clinical drugs. Here, we aimed to investigate a potential role of Period 2 (PER2) in regulating … WebNov 25, 2016 · Chronic ethanol treatment causes increased hepatic CYP2B10 expression inPparβ/δ +/+ mice but not in Pparβ/δ-/-mice. Nuclear and cytosolic localization of the …
Cyp2b10 gene card
Did you know?
WebFind many great new & used options and get the best deals for 1990 Classic WWF #51 Mean Gene Okerlund Wrestling Card Pristine Mint New at the best online prices at eBay! Free shipping for many products! WebNov 25, 2016 · Because the previous results indicate that ethanol-induced Cyp2b10 expression was not mediated by CAR activation, functional mapping of the 5′ upstream region of the Cyp2b10 gene was performed to identify important regulators that may influence ethanol-induced Cyp2b10 expression. Reporter gene assays revealed that the …
WebMar 21, 2024 · UGT2B10 (UDP Glucuronosyltransferase Family 2 Member B10) is a Protein Coding gene. Diseases associated with UGT2B10 include Crigler-Najjar Syndrome, …
WebDec 26, 2014 · Reported Gene symbol Gene name KO WT Up-regulated Ces2a carboxylesterase 2 a 2.493 2.038 Cyp2b13 cytochrome P450 family 2, subfamily b, polypeptide 13 4.695 22.644 WebAug 1, 2024 · Cytochrome P450s (P450s) are a large family of heme-containing monooxygenase enzymes that oxidatively metabolize xenobiotics such as drugs and environmental pollutants ( Gonzalez, 1988; Isin and Guengerich, 2007 ).
WebThe nuclear receptor constitutive active/androstane receptor (CAR) is sequestered in the cytoplasm of liver cells before its activation by therapeutic drugs and xenobiotics such as phenobarbital (PB) and 1,4-Bis [2- (3,5-dichloropyridyloxy)]benzene (TCPOBOP) in mouse liver, the regulatory mechanism of which remains poorly understood.
WebCytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes … diamond system s.aWebMar 28, 2024 · The Cyp2b10 guide sequence was: uguggaggagcggauucagg (AGG). The Cyp2b13 guide sequence was: (CCC)ugcaagagguuccccaagag, and the Cyp2b9 guide sequence was: acattgatacctaccttctg (AGG). The protospacer adjacent motif (PAM) is shown in parenthesis. The incorporation efficiency at each site in vitro was Cyp2b10, 47.6%, … cisgender monthWebThe constitutive androstane receptor ( CAR) also known as nuclear receptor subfamily 1, group I, member 3 is a protein that in humans is encoded by the NR1I3 gene. [5] CAR is a member of the nuclear … cisgender privilege bathroomWebCyp2b10cytochrome P450, family 2, subfamily b, polypeptide 10 [ Mus musculus(house mouse) ] Gene ID: 13088, updated on 26-Sep-2024 Download Datasets Gene Sequences (FASTA) Transcript sequences (FASTA) Protein sequences(FASTA) cisgender privilege evin taylor summaryWebOct 19, 2000 · Probes for Cyp2b10 were prepared by polymerase chain reaction after reverse transcription of RNA (RT-PCR) with mouse liver total RNA using Superscript … cisgender normativityWebOn the other hand, progesterone and androgens repressed NR1 activity in HepG2 cells, and the repressed NR1 activity was fully restored by estradiol. Moreover, estrogen treatment elicited nuclear accumulation of CAR in the mouse livers, as well as primary hepatocytes, and induced the endogenous Cyp2b10 gene. cisgender refers to gender confusionWebOct 19, 2000 · Here we show that the nuclear receptor CAR mediates the response evoked by a class of xenobiotics known as the ‘phenobarbital-like inducers’. The strong activation of Cyp2b10 gene expression ... cisgender sexueal meaning